braB [2019-03-31 15:39:29]

branched-chain amino acid transporter

Locus: BSU29600

Isoelectric point: 9.65

Molecular weight: 46.45 kDa

Protein length: 445 aa

Gene length: 1338 bp

Function: uptake of branched-chain amino acids

Product: branched-chain amino acid transporter

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → BCAA transporters
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of branched-chain amino acids
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,028,297 3,029,634

Phenotypes of a mutant

• no phenotype for the single mutant, the triple bcaP brnQ braB mutant is strongly impaired in the transport of isoleucine and valine at low concentrations PubMed

The protein

Catalyzed reaction/ biological activity

• high affinity uptake of isoleucine and valine PubMed

Protein family

• branched chain amino acid transporter family (according to Swiss-Prot)

Paralogous protein(s)

• BrnQ

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: braB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CodY: repression, PubMed, in CodY regulon
  • ScoC: repression, PubMed, in ScoC regulon

  Regulation

  • induced in the absence of branched-chain amino acids (CodY, ScoC) PubMed

  Additional information

  • note that CodY represses the expression of scoC, therefore braB expression is increased at intermediate levels of CodY activity PubMed

Biological materials

Mutant

• BKE29600 (braB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAAAAAAATCCTCCTAA, downstream forward: _UP4_TAATGTCACAGAACGCCTGC
• BKK29600 (braB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGAAAAAAATCCTCCTAA, downstream forward: _UP4_TAATGTCACAGAACGCCTGC

References

Loading